A practical reference on research chemical: what it is, how it behaves, what the literature reports, and where the honest uncertainties sit.
This page was last updated on 2026-06-20 and is reviewed periodically as new material appears.
SR9009 is a synthetic small molecule that acts on the nuclear receptors REV-ERBα and REV-ERBβ. These receptors are part of the circadian clock machinery and normally repress transcription of certain target genes. In laboratory research, SR9009 is used as a chemical tool to study how REV-ERB activity influences metabolism, inflammation, and daily biological rhythms. The compound is not an approved medicine, and its effects in humans remain largely uncharacterized. It is often described as an investigational agent rather than a therapeutic product.
REV-ERB proteins typically suppress gene expression by recruiting corepressor complexes to DNA response elements. SR9009 binds these receptors and strengthens that repressive action in cell-based assays. Studies in rodents have reported changes in lipid handling, mitochondrial function, and exercise capacity after treatment. Such findings are often cited as evidence for metabolic effects, but species differences and limited pharmacokinetic data make direct translation to humans uncertain. Researchers continue to examine which effects are robust and which depend on specific experimental conditions.
Handling practices for SR9009 focus on minimizing degradation and contamination. The solid is generally stored desiccated at or below -20 °C, protected from light and moisture. Stock solutions are often prepared in dimethyl sulfoxide or ethanol, then aliquoted to avoid repeated freeze–thaw cycles. Aqueous solubility is low, so formulations for animal studies may require cosolvents or suspending agents. Personnel should follow institutional chemical safety procedures, because toxicological data for humans are incomplete.
Regulatory status varies by country and intended use. Major drug agencies have not granted marketing authorization for SR9009 as a medicine, and it is not listed as a controlled substance in many jurisdictions. It is often sold as a research chemical, a category that may fall outside pharmaceutical manufacturing rules. Buyers should verify local laws and supplier documentation, including certificates of analysis. The lack of standardized quality controls raises concerns about identity, purity, and actual content in products marketed online.
In laboratory settings, SR9009 is commonly identified by its molecular structure and its interaction with REV-ERB receptors. Vendors may list it under synonyms such as Stenabolic or REV-ERB agonist, but those names do not define purity or identity. Analytical confirmation typically uses high-performance liquid chromatography with ultraviolet detection or liquid chromatography–mass spectrometry. A reference standard is needed to compare retention time and mass spectrum, because the compound can be confused with related research chemicals.
| Property | Value | Notes |
|---|---|---|
| Common name | SR9009 | Also marketed informally as Stenabolic |
| Chemical class | Synthetic REV-ERB agonist | Binds REV-ERBα and REV-ERBβ |
| Molecular formula | C24H30ClN3O4S | Approximate molecular weight 492 g/mol |
| CAS Registry Number | 1379686-30-2 | Identifier for the parent compound |
| Regulatory status | Not approved for human use | Prohibited in sport by WADA |
SR9009 is frequently discussed in fitness and research-chemical contexts, yet it has no approved medical indication. Regulatory agencies have not authorized it for human use, and it is not a standard prescription drug. Some sports organizations list it as a prohibited substance because of its potential performance-enhancing properties. Published human data are sparse, so claims about its effects in people often rely on animal models or anecdotal reports. Quality and identity of online materials can vary widely.
SR9009 is a synthetic small molecule studied as a REV-ERB agonist. REV-ERBα and REV-ERBβ are nuclear receptors that help regulate circadian rhythms and metabolic gene expression. The compound was identified in academic screening efforts to find synthetic ligands for these receptors. In cell and animal studies, SR9009 alters transcription of genes involved in lipid and glucose metabolism, and it can shift circadian behavior. It is not an approved therapeutic agent.
Mechanistically, SR9009 binds the ligand-binding domain of REV-ERBα/β and enhances recruitment of corepressor complexes. This represses target genes rather than activating them. Because REV-ERB proteins normally compete with ROR proteins at shared response elements, the net effect depends on tissue and timing. Researchers use SR9009 to probe how nuclear receptor signaling links the clock to metabolism, inflammation, and muscle biology. Findings are largely preclinical, and the precise contribution of each receptor subtype remains under study.
Regulatory agencies have not approved SR9009 for human therapeutic use. It is typically sold as a research chemical with labels stating that it is not for human consumption. The World Anti-Doping Agency prohibits the substance in sport, generally under the category of non-approved substances. Customs and national laws may restrict importation, sale, or possession. Product quality and legal status can vary by country and vendor, and therapeutic claims are not permitted in regulated advertising because the compound lacks approval.
Several misconceptions surround SR9009. It is often described as a SARM, a steroid, or an exercise pill, but its known target is the REV-ERB receptor family. Rodent studies have examined exercise capacity and metabolic markers, yet human outcomes remain unproven. Oral bioavailability appears low in animals, and human pharmacokinetics are not well characterized. Online products may contain impurities or different compounds, so identity and purity testing are important for research use.
SR9009 is a synthetic small molecule studied as an agonist of the nuclear receptors REV-ERBα and REV-ERBβ. These receptors help regulate circadian rhythms, lipid metabolism, and inflammatory gene expression. In cell and animal experiments, SR9009 alters transcription of clock-controlled genes and metabolic pathways. The compound is not a hormone and does not resemble classical steroid structures. Its activity depends on binding to the ligand-binding domain of REV-ERB, where it can modify corepressor recruitment.
Research interest in SR9009 grew from studies of circadian biology and metabolic disease. Preclinical reports describe effects on exercise capacity, muscle metabolism, and blood lipid levels in rodents, but these findings come from controlled laboratory settings. The compound has low oral bioavailability in animals, which limits systemic exposure after swallowing. Investigators often use injected routes in experiments to achieve measurable plasma concentrations. Human clinical data are sparse, no approved therapeutic product exists, and whether animal effects translate to humans remains an open question.
Stability depends on physical form, temperature, light exposure, and solvent. Solid SR9009 is generally stored cold and dry, with protection from light to limit degradation. Dimethyl sulfoxide stocks are common for laboratory work, but repeated freeze-thaw cycles can reduce compound integrity. Aqueous solutions may be less stable than organic stocks, and the ethyl ester in the structure can be susceptible to hydrolysis under certain conditions. Researchers typically validate storage conditions and recheck purity before quantitative experiments, especially when using archived material.
Regulatory treatment of SR9009 varies by country and region. It is not approved as a pharmaceutical, and several jurisdictions restrict its sale for human consumption. Some authorities classify it as a research chemical, a prescription-only substance, or a prohibited performance-enhancing agent in sport. Purchasers may encounter certificates of analysis, but these documents do not guarantee identity, purity, or legality. In research settings, institutional safety reviews and controlled procurement help ensure that materials are handled under appropriate oversight. The absence of harmonized rules means that legal status can change and requires verification.
Analytical identification of SR9009 typically relies on liquid chromatography coupled with tandem mass spectrometry. In biological samples, researchers first separate the compound from matrix components using protein precipitation, liquid-liquid extraction, or solid-phase extraction. High-performance liquid chromatography with ultraviolet detection and nuclear magnetic resonance spectroscopy can support structural confirmation of reference materials. Because SR9009 is a small, relatively lipophilic molecule, reverse-phase columns and acidic mobile phases are common. Laboratories often include isotope-labeled internal standards to improve quantification and to correct for ion suppression.
White blood cells The G-CSF-receptor is present on precursor cells in the bone marrow, and, in response to stimulation by G-CSF, initiates proliferation and differentiation into mature granulocytes. G-CSF stimulates the survival, proliferation, differentiation, and function of neutrophil precursors and mature neutrophils. G-CSF regulates them using Janus kinase (JAK)/signal transducer and activator of transcription (STAT) and Ras/mitogen-activated protein kinase (MAPK) and phosphatidylinositol 3-kinase (PI3K)/protein kinase B (Akt) signal transduction pathway. Hematopoietic System G-CSF is also a potent inducer of hematopoietic stem cell (HSC) mobilization from the bone marrow into the bloodstream, although it has been shown that it does not directly affect the hematopoietic progenitors that are mobilized. Neurons G-CSF can also act on neuronal cells as a neurotrophic factor. Indeed, its receptor is expressed by neurons in the brain and spinal cord. The action of G-CSF in the central nervous system is to induce neurogenesis, to increase the neuroplasticity and to counteract apoptosis. These properties are currently under investigations for the development of treatments of neurological diseases such as cerebral ischemia.
After the Third Partition of Poland in 1795, Poland had ceased to exist as an independent state. From 1795 through the beginning of World War I, several unsuccessful uprisings to regain independence took place. The Great Poland Uprising of 1806 was followed by the creation of the Duchy of Warsaw, which lasted for eight years before it was partitioned again between Prussia and Russia. Under German rule, Poles faced systematic discrimination and oppression. The Poles living in the region of Greater Poland were subjected to Germanisation and land confiscations to make way for German colonization. At the end of World War I, US President Woodrow Wilson's Fourteen Points and the idea of national self-determination were met with opposition from European powers standing to lose influence or territory, such as Germany, which dominated Greater Poland. German politicians had signed an armistice leading to a ceasefire on 11 November 1918. Also, Germany had signed the Treaty of Brest-Litovsk with Bolshevik Russia to settle the territorial boundaries of the eastern frontiers. That treaty took into consideration of a future Polish state and so from then until the Treaty of Versailles was fully ratified in January 1920 many territorial and sovereignty issues remained unresolved. Wilson's proposal for an independent Poland initially did not set borders that could be universally accepted.
=== Anti-thyroid drugs === Treatment with methimazole or propylthiouracil for hyperthyroidism, is commonly associated with an elevation of liver enzymes. To differentiate between hyperthyroidism and drug-related liver injury, it is recommended to check baseline liver enzymes prior to initiation of treatment. If liver injury related to anti-thyroid treatment is significant, switching to the alternative agent can be attempted in most cases. Cases of fulminant liver failure reported with propylthiouracil have led to a regulatory warning, and to guidelines recommending methimazole as the first line anti-thyroid agent.
In pre-life, a 31 nucleotide D loop minihelix (GCGGCGGUAGCCUAGCCUAGCCUACCGCCGC) was ligated to two 31 nucleotide anticodon loop minihelices (GCGGCGGCCGGGCU/???AACCCGGCCGCCGC; / indicates a U-turn conformation in the RNA backbone; ? indicates unknown base identity) to form the 93 nucleotide tRNA precursor. To generate type II tRNAs, a single internal 9 nucleotide deletion occurred within ligated acceptor stems (CCGCCGCGCGGCGG goes to GGCGG). To generate type I tRNAs, an additional, related 9 nucleotide deletion occurred within ligated acceptor stems within the variable loop region (CCGCCGCGCGGCGG goes to CCGCC). These two 9 nucleotide deletions are identical on complementary RNA strands. tRNAomes (all of the tRNAs of an organism) were generated by duplication and mutation. Very clearly, life evolved from a polymer world that included RNA repeats and RNA inverted repeats (stem-loop-stems). Of particular importance were the 7 nucleotide U-turn loops (CU/???AA). After LUCA (the last universal common (cellular) ancestor), the T loop evolved to interact with the D loop at the tRNA "elbow" (T loop: UU/CAAAU, after LUCA). Polymer world progressed to minihelix world to tRNA world, which has endured for ~4 billion years. Analysis of tRNA sequences reveals a major successful pathway in evolution of life on Earth.
Sources: en.wikipedia.org
== Safe cities == Safe Cities Index 2019, published by the Economist Intelligence Unit, ranked 60 world cities on such criteria as personal safety, digital security, and infrastructure security. Bangkok ranked 47 of 60 (1=most safe; 60=least safe), tied with Ho Chi Minh City. Other ASEAN cities ranked were Singapore, 2; Kuala Lumpur, 35; Manila, 43; Jakarta, 53.
When most of the alar lobule tissue is missing, the nose collapses; the correction is with an ear concha cartilage-graft harvested from the antihelix, a donor site where the cartilage is most rigidly curved, thus is ideal for replacing an alar lobule. Nasal skin defects can be corrected with a medially based bilobed flap, which is emplaced to provide adequate skin coverage for wounds limited to the alar lobule. If the entire lobule is missing, it might be necessary to leave the second-lobe donor-site wound partially open; it will close at 2–4 weeks post-operative; afterwards, the scar can be revised. Nonetheless, the alternative surgical correction is a two-stage, superiorly based, nasolabial flap. If the alar lobule defect also comprehends the lateral wall of the nose, the defect can be closed either with a superiorly based nasolabial-flap or with a forehead flap. If the cheek skin is thin and atrophic, a nasolabial flap is the recommended reconstruction; otherwise, a forehead flap is recommended, because the thickness of forehead skin is a superior match for nasal skin and tissue. Mucosal lining defects of the alar lobule can be resurfaced with a bipedicled mucosal advancement-flap harvested from inside the lateral wall of the nose. Likewise, larger defects of the mucosa do require correction with an anteriorly based septal mucosal flap. III.
The four substrates of this enzyme are salicylic acid, reduced nicotinamide adenine dinucleotide (NADH), oxygen, and a proton, Its products are catechol, oxidised NAD+, water, and carbon dioxide. The enzyme is a flavin-containing monooxygenase that uses molecular oxygen as oxidant and incorporates one of its atoms into the starting material. This enzyme participates in metabolic pathways involving the degradation of naphthalene and anthracene and some of their derivatives. It uses flavin adenine dinucleotide as a cofactor.
=== Medicinal applications === Human growth hormone (rHGH): Humatrope from Lilly and Serostim from Serono replaced cadaver harvested human growth hormone human insulin (BHI): Humulin from Lilly and Novolin from Novo Nordisk among others largely replaced bovine and porcine insulin for human therapy. Some prefer to continue using the animal-sourced preparations, as there is some evidence that synthetic insulin varieties are more likely to induce hypoglycemia unawareness. Remaining manufacturers of highly purified animal-sourced insulin include the U.K.'s Wockhardt Ltd. (headquartered in India), Argentina's Laboratorios Beta S.A., and China's Wanbang Biopharma Co. Follicle-stimulating hormone (FSH) as a recombinant gonadotropin preparation replaced Serono's Pergonal which was previously isolated from post-menopausal female urine Factor VIII: Kogenate from Bayer replaced blood harvested factor VIII
=== Two-dimensional nanostructures === 2D materials are crystalline materials consisting of a two-dimensional single layer of atoms. The most important representative graphene was discovered in 2004. Thin films with nanoscale thicknesses (nanofilms) are considered nanostructures, but are sometimes not considered nanomaterials because they do not exist separately from the substrate.
Sources: en.wikipedia.org
SR9009 is a synthetic research compound that binds and modulates the nuclear receptors REV-ERBα and REV-ERBβ. It is used in laboratory studies of circadian biology and metabolism, not as an approved medicine. It is also known by the informal name Stenabolic.
No. SR9009 has not been approved as a therapeutic drug in the United States, European Union, or other major markets. Human safety and efficacy data are very limited. Its presence in consumer products does not imply regulatory approval.
The World Anti-Doping Agency lists SR9009 as a prohibited substance because it can alter gene expression and metabolic pathways relevant to performance. The ban applies at all times, not only during competition. Detection relies on laboratory methods such as mass spectrometry.
Liquid chromatography–mass spectrometry is common for identity and purity checks. High-performance liquid chromatography with ultraviolet detection can also be used. Both methods require a suitable reference standard.