The short version of research chemical fits in a sentence. The long version — which is the one that helps — is below.
Reviewed 2025-08-23. Anything still debated is marked as such rather than presented as settled.
Storage conditions for research-grade SR9009 generally involve a freezer at approximately minus twenty degrees Celsius, sometimes lower for long-term preservation. Containers should remain tightly closed and protected from light. Desiccants may be used to limit moisture uptake. Solutions are often stored in aliquots to avoid repeated warming and cooling. Stability data for the compound under various conditions are limited, so laboratories typically follow supplier recommendations and verify performance through periodic analytical checks rather than assuming indefinite stability.
Identity and purity testing for SR9009 commonly uses liquid chromatography coupled with tandem mass spectrometry. This method separates the compound from matrix components and detects it by mass-to-charge transitions, providing sensitive and specific confirmation. Nuclear magnetic resonance spectroscopy can support structural identification, while high-performance liquid chromatography with ultraviolet detection may estimate purity. Because online products labeled as SR9009 may contain other substances or no active compound at all, independent verification is important in research settings. Certificates of analysis are useful but not a substitute for in-house testing.
Regulatory treatment of SR9009 varies by country and region. It is not approved as a pharmaceutical, and several jurisdictions restrict its sale for human consumption. Some authorities classify it as a research chemical, a prescription-only substance, or a prohibited performance-enhancing agent in sport. Purchasers may encounter certificates of analysis, but these documents do not guarantee identity, purity, or legality. In research settings, institutional safety reviews and controlled procurement help ensure that materials are handled under appropriate oversight. The absence of harmonized rules means that legal status can change and requires verification.
Analytical identification of SR9009 typically relies on liquid chromatography coupled with tandem mass spectrometry. In biological samples, researchers first separate the compound from matrix components using protein precipitation, liquid-liquid extraction, or solid-phase extraction. High-performance liquid chromatography with ultraviolet detection and nuclear magnetic resonance spectroscopy can support structural confirmation of reference materials. Because SR9009 is a small, relatively lipophilic molecule, reverse-phase columns and acidic mobile phases are common. Laboratories often include isotope-labeled internal standards to improve quantification and to correct for ion suppression.
Stability depends on physical form, temperature, light exposure, and solvent. Solid SR9009 is generally stored cold and dry, with protection from light to limit degradation. Dimethyl sulfoxide stocks are common for laboratory work, but repeated freeze-thaw cycles can reduce compound integrity. Aqueous solutions may be less stable than organic stocks, and the ethyl ester in the structure can be susceptible to hydrolysis under certain conditions. Researchers typically validate storage conditions and recheck purity before quantitative experiments, especially when using archived material.
| Property | Value | Notes |
|---|---|---|
| Appearance | White to off-white powder | Typical for research-grade material |
| Solubility | Soluble in DMSO and ethanol; low aqueous solubility | Organic stock solutions are common |
| Typical storage temperature | -20 °C or lower | Protect from light and moisture |
| Common analytical method | LC-MS/MS | Used for detection and confirmation |
| Common synonyms | SR9009; Stenabolic | Stenabolic is an informal name |
At the molecular level, SR9009 binds the ligand-binding domain of REV-ERB and strengthens recruitment of corepressor proteins such as NCoR and HDAC3. This increases repression of target genes, including Bmal1 and other clock-controlled and metabolic genes. In rodent studies, such changes have been linked to altered lipid handling, glucose metabolism, and energy expenditure. The precise chain of events between receptor binding and whole-body effects remains an active area of research. Findings in animals do not automatically translate to humans.
Laboratory studies often administer SR9009 by injection because oral absorption appears poor in rodents. Reported pharmacokinetic properties include rapid metabolism and low systemic exposure after oral dosing. Human pharmacokinetic data are sparse, so absorption, distribution, metabolism, and excretion in people are not well defined. Some research explores related REV-ERB compounds with improved drug-like properties. Regulatory approval for any REV-ERB agonist as a human medicine has not been granted to date.
== Chemical properties == Copper(II) sulfate pentahydrate decomposes before melting. It loses two water molecules upon heating at 63 °C (145 °F), followed by two more at 109 °C (228 °F) and the final water molecule at 200 °C (392 °F). The chemistry of aqueous copper sulfate is simply that of copper aquo complex, since the sulfate is not bound to copper in such solutions. Thus, such solutions react with concentrated hydrochloric acid to give tetrachlorocuprate(II):
In pre-life, a 31 nucleotide D loop minihelix (GCGGCGGUAGCCUAGCCUAGCCUACCGCCGC) was ligated to two 31 nucleotide anticodon loop minihelices (GCGGCGGCCGGGCU/???AACCCGGCCGCCGC; / indicates a U-turn conformation in the RNA backbone; ? indicates unknown base identity) to form the 93 nucleotide tRNA precursor. To generate type II tRNAs, a single internal 9 nucleotide deletion occurred within ligated acceptor stems (CCGCCGCGCGGCGG goes to GGCGG). To generate type I tRNAs, an additional, related 9 nucleotide deletion occurred within ligated acceptor stems within the variable loop region (CCGCCGCGCGGCGG goes to CCGCC). These two 9 nucleotide deletions are identical on complementary RNA strands. tRNAomes (all of the tRNAs of an organism) were generated by duplication and mutation. Very clearly, life evolved from a polymer world that included RNA repeats and RNA inverted repeats (stem-loop-stems). Of particular importance were the 7 nucleotide U-turn loops (CU/???AA). After LUCA (the last universal common (cellular) ancestor), the T loop evolved to interact with the D loop at the tRNA "elbow" (T loop: UU/CAAAU, after LUCA). Polymer world progressed to minihelix world to tRNA world, which has endured for ~4 billion years. Analysis of tRNA sequences reveals a major successful pathway in evolution of life on Earth.
The fur is soft, with dense underfur and long, coarse, thick guard hairs. The fur is not as shaggy or coarse as that of brown bears. American black bear skins can be distinguished from those of Asian black bears by the lack of a white blaze on the chest and hairier footpads. Despite their name, black bears show a great deal of color variation. Individual coat colors can range from white, blonde, cinnamon, light brown or dark chocolate brown to jet black, with many intermediate variations existing. Silvery-gray American black bears with a blue luster (found mostly on the flanks) occur along a portion of coastal Alaska and British Columbia. White to cream-colored American black bears occur in the coastal islands and the adjacent mainland of southwestern British Columbia. Albino individuals have also been recorded. Black coats tend to predominate in humid areas, such as Maine, New England, New York, Tennessee, Michigan and western Washington. Approximately 70% of all American black bears are black, though only 50% in the Rocky Mountains are black. Many in northwestern North America are cinnamon, blonde or light brown in color and thus may sometimes be mistaken for grizzly bears. Grizzly (and other types of brown) bears can be distinguished by their shoulder hump, larger size and broader, more concave skull. In his book The Great Bear Almanac, Gary Brown summarized the predominance of black or brown/blonde specimens by location:
Because the use of broad-spectrum antibiotics encourages the spread of multidrug-resistant strains and the development of Clostridioides difficile infections, treatment guidelines often recommend minimizing the use of fluoroquinolones and other broad-spectrum antibiotics in less severe infections and in those in which risk factors for multidrug resistance are not present. It has been recommended that fluoroquinolones not be used as a first-line agent for community-acquired pneumonia, instead recommending macrolide or doxycycline as first-line agents. The Drug-Resistant Streptococcus pneumoniae Working Group recommends fluoroquinolones be used for the ambulatory treatment of community-acquired pneumonia only after other antibiotic classes have been tried and failed, or in cases with demonstrated drug-resistant Streptococcus pneumoniae. Resistance to quinolones can evolve rapidly, even during a course of treatment. Numerous pathogens, including Escherichia coli, commonly exhibit resistance. Widespread veterinary usage of quinolones, in particular in Europe, has been implicated. Fluoroquinolones had become the class of antibiotics most commonly prescribed to adults in 2002. Nearly half (42%) of these prescriptions were for conditions not approved by the U.S. FDA, such as acute bronchitis, otitis media, and acute upper respiratory tract infection, according to a study supported in part by the Agency for Healthcare Research and Quality.
In chemistry, an enantiomer (/ɪˈnænti.əmər, ɛ-, -oʊ-/ ih-NAN-tee-ə-mər), also known as an optical isomer, antipode, or optical antipode, is one of a pair of molecular entities which are mirror images of each other and non-superposable. Enantiomer molecules are like right and left hands: one cannot be superposed onto the other without first being converted to its mirror image. It is solely a relationship of chirality and the permanent three-dimensional relationships among molecules or other chemical structures: no amount of re-orientation of a molecule as a whole or conformational change converts one chemical into its enantiomer. Chemical structures with chirality rotate plane-polarized light. A mixture of equal amounts of each enantiomer, a racemic mixture or a racemate, does not rotate light. Stereoisomers include both enantiomers and diastereomers. Diastereomers, like enantiomers, share the same molecular formula and are also non-superposable onto each other; however, they are not mirror images of each other. In nature, most chiral compounds are only present as one enantiomer, such as amino acids—for example, only the L-isomer of alanine is incorporated into proteins.
Sources: en.wikipedia.org
At Mulhouse, Wenger was managed by Paul Frantz, who also had a profound impact on his career. It was he who formalised Wenger's beliefs on the importance of nutrition, isometrics and working on a player's strong points. Wenger played in midfield for Mulhouse, often positioned on the right. In their final game of the 1974–75 season, the club beat Nancy to avoid relegation, but shortly afterwards, Frantz resigned. Wenger also made the decision to leave, as the regular commutes to Mulhouse from Strasbourg overwhelmed him. In 1975, he rekindled his friendship with Hild and signed for amateur club ASPV Strasbourg (Vauban). Hild needed a midfielder "who could organise play and also have a sort of hold over the team" and decided to recruit Wenger. Vauban was formed in 1971, and made steady progress up the French football league system thereafter; Wenger's three seasons at the club culminated with promotion to the third division.
The new 24th district, centered on Dallas Fort Worth International Airport in the heart of the Dallas–Fort Worth metroplex, encompasses the suburbs north of Fort Worth and Dallas, including Grapevine, Bedford, North Richland Hills and Southlake in northeast Tarrant County, and the wealthy Park Cities north of downtown Dallas, as well as the neighboring Knox Park and Lower Greenville neighborhoods and most of north Dallas (including Preston Hollow) in Dallas itself and the Dallas County suburbs of Farmers Branch and Coppell. Due to redistricting, the district has two incumbents, Republican Beth Van Duyne, who was re-elected with 60.3% of the vote in 2024, and Democrat Julie Johnson, who was elected with 61.9% of the vote in 2024 from the old 32nd District. Donald Trump won 57.1% of the vote in this affluent district, which also gave Ted Cruz 54.6% of the vote that same year against Democrat Colin Allred, whom Johnson succeeded in Congress. Johnson has since decided to seek reelection in the newly redrawn 33rd district (see below).
Its smooth muscle is innervated by involuntary nerves (sympathetic nerves via the sympathetic trunk and parasympathetic nerves via the vagus nerve) and in addition voluntary nerves (lower motor neurons) which are carried in the vagus nerve to innervate its striated muscle. The esophagus may be affected by gastric reflux, cancer, prominent dilated blood vessels called varices that can bleed heavily, tears, constrictions, and disorders of motility. Diseases may cause difficulty swallowing (dysphagia), painful swallowing (odynophagia), chest pain, or cause no symptoms at all. Clinical investigations include X-rays when swallowing barium sulfate, endoscopy, and CT scans. Surgically, the esophagus is difficult to access in part due to its position between critical organs and directly between the sternum and spinal column.
where A is the anion. ETD cleaves randomly along the peptide backbone (c and z ions) while side chains and modifications such as phosphorylation are left intact. The technique only works well for higher charge state ions (z>2), however relative to collision-induced dissociation (CID), ETD is advantageous for the fragmentation of longer peptides or even entire proteins. This makes the technique important for top-down proteomics. Much like ECD, ETD is effective for peptides with modifications such as phosphorylation. Electron-transfer and higher-energy collision dissociation (EThcD) is a combination ETD and HCD where the peptide precursor is initially subjected to an ion/ion reaction with fluoranthene anions in a linear ion trap, which generates c- and z-ions. In the second step HCD all-ion fragmentation is applied to all ETD derived ions to generate b- and y- ions prior to final analysis in the orbitrap analyzer. This method employs dual fragmentation to generate ion- and thus data-rich MS/MS spectra for peptide sequencing and PTM localization.
Sources: en.wikipedia.org
Research-grade SR9009 is typically stored frozen at about minus twenty degrees Celsius, protected from light and moisture. Stock solutions are often kept in aliquots to avoid repeated freeze-thaw cycles. Specific storage conditions should follow the supplier's documentation.
Liquid chromatography with tandem mass spectrometry is widely used to detect and confirm SR9009 in laboratory samples. The technique offers high sensitivity and can distinguish the target compound from related substances. Nuclear magnetic resonance and ultraviolet detection may support identity and purity checks.
Online products labeled as SR9009 may vary in identity, purity, and actual content. Independent testing helps confirm that a sample matches its label and does not contain unexpected contaminants. This is important for reproducible research and for interpreting experimental results.
The most common approach is liquid chromatography-tandem mass spectrometry, often after extraction from blood, urine, or tissue. Ultraviolet detection and nuclear magnetic resonance spectroscopy are used mainly for reference material characterization. Isotope-labeled internal standards improve accuracy.